Diagenode

Tagmentase (Tn5 transposase) - unloaded

Catalog Number
Format
Price
C01070010-10
10 µl
$355.00
Other format


The Hologic Diagenode Tagmentase (unloaded) is a hyperactive Tn5 transposase that is not pre-loaded with DNA oligonucleotides, providing flexibility for diverse applications. Before use, the enzyme must be loaded with the desired oligonucleotides. For optimal performance, we recommend following the Protocol for Transposome Assembly. If needed, the enzyme concentration can be adjusted using the Hologic Diagenode Tagmentase Dilution Buffer (Cat. No. C01070011), which is sold separately.

The Tagmentase Tn5 transposase can simultaneously cleave DNA and integrate oligonucleotides—such as sequencing adapters—in a single step. This makes it suitable for Next-Generation Sequencing (NGS) workflows, including ATAC-seq, ChIPmentation, CHANGE-seq, and other tagmentation-based applications. The unloaded version of Tagmentase offers enhanced versatility, as it can be customized with any oligonucleotides and adapted to a wide range of experimental needs.

Additional Items You May Need

Looking for a loaded Tagmentase? Check out Tagmentase (Tn5 transposase) - loaded.
Learn more about Tagmentation

 

TESTIMONIAL

We experienced strong purity and activity differences between in-house produced Tn5 batches and switched to buying Tn5 from Diagenode with higher activity and small batch effects only.

Rebekka Scholz et al. Combined Analysis of mRNA Expression and Open Chromatin in Microglia. Methods Mol Biol. 2024;2713:543-571.
TESTIMONIAL

We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!

Julia Liz Touza, AstraZeneca Gothenburg, Sweden
  • Product information

    Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.


     Mosaic end_reverse: 5’ [PHO]CTGTCTCTTATACACATCT 3’
     Mosaic end_Adapter A: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’
     Mosaic end_Adapter B: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’


    Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.
    The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:
     8 UDI for tagmented libraries - Hologic Diagenode, Cat. No. C01011035
     24 UDI for tagmented libraries (Set I) - Hologic Diagenode, Cat. No. C01011034
     24 UDI for tagmented libraries (Set II) - Hologic Diagenode, Cat. No. C01011036
     24 UDI for tagmented libraries (Set III) - Hologic Diagenode, Cat. No. C01011037


    Unit (U) Definition
    One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.


    Storage Conditions
    • Store at -20°C.
    • Guaranteed stable for six months from the date of receipt when stored properly.


    Storage Buffer
    • Supplied in a solution containing 50% (v/v) glycerol.

    Properties & Usage
    • Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.
    • pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.
    • Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.


    Recommended Buffers
    • Tagmentase Dilution Buffer - Hologic Diagenode, Cat. No. C01070011
    • Tagmentation Buffer (2x) - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use


    Applications
    Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:
    • Genomic DNA tagmentation: 0.25–1 U per 25–100 ng of DNA
    • ATAC-seq: 0.3 U per 50,000 cells
    • ChIPmentation: 0.125 U per reaction


    Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for
    custom protocols.


    Recommended Protocols
    For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:
     ATAC-seq Kit - Hologic Diagenode, Cat. No. C01080002
     ChIPmentation Kit for Histones - Hologic Diagenode, Cat. No. C01011009
     μChIPmentation Kit for Histones - Hologic Diagenode, Cat. No. C01011011
     TAG Kit for ChIPmentation - Hologic Diagenode, Cat. No. C01011030


    Quality Control
    Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The
    following assays are performed:
    • Protein Purity and Integrity by SDS-PAGE
    • Nuclease Activity to confirm the absence of nonspecific DNase activity
    • Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation
    • Functional by ATAC-seq, including checks for contaminating DNA from E. coli


    Precautions
    This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.

  • Example of results

    Example of results - Tagmentation of Lambda DNA

    Figure 1. Tagmentation of Lambda DNA

    Figure 1 shows the size distribution of DNA fragments produced during a tagmentation reaction performed on 25 ng of lambda DNA. The reaction was carried out using different amounts of Tagmentase (Tn5 transposase) in Tagmentation Buffer 2x (Cat. No. C01019043). Before the experiment, Tagmentase (Tn5 transposase) (Cat. No. C01070010) was preloaded in accordance with the Hologic Diagenode Protocol for Transposome Assembly. Following tagmentation, DNA fragments were purified using AMPure beads and analyzed on an Agilent Fragment Analyzer using the High Sensitivity Large Fragment Kit.

    For additional examples of results, please see: Tagmentase (Tn5 transposase) - loaded.

  •  Documents
    Tagmentase datasheet DATASHEET
    Diagenode Tagmentase is a hyperactive transposase with the ability to cut DNA and insert sequence...
    Download
    Transposome assembly using Diagenode Tagmentase PROTOCOL
    Transposome assembly using Diagenode Tagmentase protocol
    Download
  •  Safety sheets
    Tagmentase Tn5 transposase SDS GB en Download
    Tagmentase Tn5 transposase SDS US en Download
    Tagmentase Tn5 transposase SDS BE nl Download
    Tagmentase Tn5 transposase SDS FR fr Download
    Tagmentase Tn5 transposase SDS BE fr Download
    Tagmentase Tn5 transposase SDS ES es Download
    Tagmentase Tn5 transposase SDS JP ja Download
    Tagmentase Tn5 transposase SDS DE de Download
  •  Publications

    How to properly cite our product/service in your work

    We strongly recommend using this: Tagmentase (Tn5 transposase) - unloaded (Hologic Diagenode Cat# C01070010-10). Click here to copy to clipboard.

    Using our products or services in your publication? Let us know!

    RSK1-driven TRIM28/E2F1 feedback loop promotes castration-resistant prostate cancer progression
    Kim, Miyeong et al.
    Castration-resistant prostate cancer (CRPC) marks the advanced and lethal stage of prostate cancer (PCa). TRIM28, also known as KAP1, is a transcriptional regulator recently shown to promote CRPC cell proliferation and xenograft tumor growth. Nonetheless, knowledge gaps persist regarding the mechanisms underlying ...

    Unified molecular approach for spatial epigenome, transcriptome, and cell lineages
    Huang, YH., et al.
    Spatial epigenomics and multiomics can provide fine-grained insights into cellular states but their widespread adoption is limited by the requirement for bespoke slides and capture chemistries for each data modality. Here, we present SPatial assay for Accessible chromatin, Cell lineages, and gene Expression with seq...

    Embryo-scale single-cell chemical transcriptomics reveals dependencies between cell types and signaling pathways
    Barkan, E., et al.
    Summary Organogenesis is a highly organized process that is conserved across vertebrates and is heavily dependent on intercellular signaling to achieve cell type identity. We lack a comprehensive understanding of how developing cell types in each organ and tissue depend on developmental signaling pathways. To addre...

    Spatial transcriptomic imaging of an intact organism using volumetric DNA microscopy
    Qian, N., Weinstein, J.A.
    Lymphatic, nervous and tumor tissues exhibit complex physiology arising from three-dimensional interactions within genetically unique microenvironments. Here we develop a technology capable of volumetrically imaging transcriptomes, genotypes and morphologies in a single measurement, without relying on prior knowledg...

    Spatially resolved genome-wide joint profiling of epigenome and transcriptome with spatial-ATAC-RNA-seq and spatial-CUT&Tag-RNA-seq
    Haikuo Li et al.
    The epigenome of a cell is tightly correlated with gene transcription, which controls cell identity and diverse biological activities. Recent advances in spatial technologies have improved our understanding of tissue heterogeneity by analyzing transcriptomics or epigenomics with spatial information preserved, but ha...

    Multi-step genomics on single cells and live cultures in sub-nanoliter capsules
    Mazelis I, et al.
    Abstract Single-cell genomics encompasses a set of methods whereby hundreds to millions of cells are individually subjected to multiplexed assays including sequencing DNA, chromatin accessibility or modification, RNA, or combinations thereof 1,2. These methods enable unbiased, systematic discovery of cellular ...

    Recurrent patterns of widespread neuronal genomic damage shared by major neurodegenerative disorders
    Zinan Zhou et al.
    Amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), and Alzheimer's disease (AD) are common neurodegenerative disorders for which the mechanisms driving neuronal death remain unclear. Single-cell whole-genome sequencing of 429 neurons from three C9ORF72 ALS, six C9ORF72 FTD, seven AD, and twenty-thre...

    Diverse somatic genomic alterations in single neurons in chronic traumatic encephalopathy
    Guanlan Dong et al.
    Chronic traumatic encephalopathy (CTE) is a neurodegenerative disease that is linked to exposure to repetitive head impacts (RHI), yet little is known about its pathogenesis. Applying two single-cell whole-genome sequencing methods to hundreds of neurons from prefrontal cortex of 15 individuals with CTE, and 4 with ...

    Combinatorial mapping of E3 ubiquitin ligases to their target substrates
    Chase C. Suiter et al.
    Highlights Developed a combinatorial assay to test E3-substrate interactions at scale Identified known and unknown E3-substrate relationships across three screens Assessment of in silico models points to scalable computational substrate discovery Computed models of E3-...

    Minimization of gene editing off-target effects by tissue restriction of expression
    Nam-Gyun Kim et al.
    Therapeutic in vivo gene editing with highly specific nucleases has the potential to revolutionize treatment for a wide range of human diseases, including genetic disorders and latent viral infections like herpes simplex virus (HSV). However, challenges regarding specificity, efficiency, delivery, and safe...

    Cells transit through a quiescent-like state to convert to neurons at high rates
    A. Beitz et al.
    While transcription factors (TFs) provide essential cues for directing and redirecting cell fate, TFs alone are insufficient to drive cells to adopt alternative fates. Rather, transcription factors rely on receptive cell states to induce novel identities. Cell state emerges from and is shaped by cellular history and...

    Enhancing single-cell ATAC sequencing with formaldehyde fixation, cryopreservation, and multiplexing for flexible analysis
    Tobias Hohl et al.
    The assay for transposase-accessible chromatin using sequencing (ATAC-seq) revolutionized the field of epigenetics since its emergence by providing a means to uncover chromatin dynamics and other factors affecting gene expression. The development of single-cell (sc) applications in recent years led to an even deeper...

    Engineered PsCas9 enables therapeutic genome editing in mouse liver with lipid nanoparticles
    Dmitrii Degtev et al.
    Clinical implementation of therapeutic genome editing relies on efficient in vivo delivery and the safety of CRISPR-Cas tools. Previously, we identified PsCas9 as a Type II-B family enzyme capable of editing mouse liver genome upon adenoviral delivery without detectable off-targets and reduced chromosomal translocat...

    AistSeq: An In-House Tn5-Based Plasmid Sequencing Platform Using A Compact Benchtop Sequencer
    Hayato Suzuki et al.
    Sequence verification of plasmids is a fundamental process in synthetic biology. For plasmid sequence verification using next-generation sequencing (NGS) library preparation, Tn5 transposase is widely used. Streamlined sequencing workflow for laboratory-scale applications is important; however, recombinant Tn5 produ...

    Rational design of peak calling parameters for TIP-seq based on pA-Tn5 insertion patterns improves predictive power
    Thomas Roberts et al.
    Epigenomic profiling provides insights into the regulatory mechanisms that govern gene expression. At a fundamental level, these mechanisms are determined by proteins that bind the DNA or modify the chromatin. Techniques such as ChIP-seq and CUT&Tag have been instrumental in mapping the binding sites of such pro...

    Multiplex, single-cell CRISPRa screening for cell type specific regulatory elements
    Florence M. Chardon et al.
    CRISPR-based gene activation (CRISPRa) is a strategy for upregulating gene expression by targeting promoters or enhancers in a tissue/cell-type specific manner. Here, we describe an experimental framework that combines highly multiplexed perturbations with single-cell RNA sequencing (sc-RNA-seq) to identify cell-typ...

    Auto-expansion of in vivo HDAd-transduced hematopoietic stem cells by constitutive expression of tHMGA2
    Wang H. et al.
    We developed an in vivo hematopoietic stem cell (HSC) gene therapy approach that does not require cell transplantation. To achieve therapeutically relevant numbers of corrected cells, we constructed HSC-tropic HDAd5/35++ vectors expressing a 3′ UTR truncated HMGA2 gene and a GFP reporter gene. A...

    Single cell genome and epigenome co-profiling reveals hardwiring and plasticity in breast cancer
    Kaile Wang et al.
    Understanding the impact of genetic alterations on epigenomic phenotypes during breast cancer progression is challenging with unimodal measurements. Here, we report wellDA-seq, the first high-genomic resolution, high-throughput method that can simultaneously measure the whole genome and chromatin accessibility profi...

    Precision and efficacy of RNA-guided DNA integration in high-expressing muscle loci
    Made Harumi Padmaswari et al.
    Gene replacement therapies primarily rely on adeno-associated virus (AAV) vectors for transgene expression. However, episomal expression can decline over time due to vector loss or epigenetic silencing. CRISPR-based integration methods offer promise for long-term transgene insertion. While the development of transge...

    Detection of genome structural variation in normal cells and tissues by single molecule sequencing
    Heid J. et al.
    Detecting somatic mutations in normal cells and tissues is notoriously challenging due to their low abundance, orders of magnitude below the sequencing error rate. While several techniques, such as single-cell and single-molecule sequencing, have been developed to identify somatic mutations, they are insufficient fo...

    Technical considerations for cost-effective transposon directed insertion-site sequencing (TraDIS)
    Kyono Y. et al.
    Transposon directed insertion-site sequencing (TraDIS), a variant of transposon insertion sequencing commonly known as Tn-Seq, is a high-throughput assay that defines essential bacterial genes across diverse growth conditions. However, the variability between laboratory environments often requires laborious, time-co...

    MED1 IDR acetylation reorganizes the transcription preinitiation complex, rewires 3D chromatin interactions and reprograms gene expression
    Ran Lin et al.
    With our current appreciation of the complexity of eukaryotic transcription, whose dysregulation drives diseases including cancer, it is becoming apparent that identification of key events coordinating multiple aspects of transcriptional regulation is of special importance. To elucidate how assembly of RNA polymeras...

    Plasticity-induced repression of Irf6 underlies acquired resistance to cancer immunotherapy in pancreatic ductal adenocarcinoma
    Kim IK et al.
    Acquired resistance to immunotherapy remains a critical yet incompletely understood biological mechanism. Here, using a mouse model of pancreatic ductal adenocarcinoma (PDAC) to study tumor relapse following immunotherapy-induced responses, we find that resistance is reproducibly associated with an epithelial-to-mes...

    CompDuplex: Accurate detection of somatic mutations by duplex-seq with comprehensive genome coverage
    Muchun Niu et al.
    Somatic mutations continuously accumulate in the human genome, posing vulnerabilities towards aging and increased risk of various diseases. However, accurate detection of somatic mutations at the whole genome scale is still challenging. By tagging and independently sequencing the two complementar...

    Integrative functional genomic analyses identify genetic variants influencing skin pigmentation in Africans
    Yuanqing Feng et al.
    Skin color is highly variable in Africans, yet little is known about the underlying molecular mechanism. Here we applied massively parallel reporter assays to screen 1,157 candidate variants influencing skin pigmentation in Africans and identified 165 single-nucleotide polymorphisms showing differential regulatory a...

    High-capacity sample multiplexing for single cell chromatin accessibility profiling
    Gregory T. Booth et al.
    Single-cell chromatin accessibility has emerged as a powerful means of understanding the epigenetic landscape of diverse tissues and cell types, but profiling cells from many independent specimens is challenging and costly. Here we describe a novel approach, sciPlex-ATAC-seq, which uses unmodified DNA oligos as samp...

    A Type II-B Cas9 nuclease with minimized off-targets and reduced chromosomal translocations in vivo
    Bestas B. et al.
    Streptococcus pyogenes Cas9 (SpCas9) and derived enzymes are widely used as genome editors, but their promiscuous nuclease activity often induces undesired mutations and chromosomal rearrangements. Several strategies for mapping off-target effects have emerged, but they suffer from limited sensitivity. To i...

    Combined Analysis of mRNA Expression and Open Chromatin in Microglia
    Scholz R.et al.
    The advance of single-cell RNA-sequencing technologies in the past years has enabled unprecedented insights into the complexity and heterogeneity of microglial cell states in the homeostatic and diseased brain. This includes rather complex proteomic, metabolomic, morphological, transcriptomic, and epigenetic adaptat...

    Volumetric imaging of an intact organism by a distributed molecular network
    Nianchao Qian and Joshua A Weinstein
    Lymphatic, nervous, and tumoral tissues, among others, exhibit physiology that emerges from three-dimensional interactions between genetically unique cells. A technology capable of volumetrically imaging transcriptomes, genotypes, and morphologies in a single de novo measurement would therefore provide a critical vi...

    CXCR4 signaling strength regulates hematopoietic multipotent progenitor fate through extrinsic and intrinsic mechanisms
    Vincent Rondeau et al.
    How cell-extrinsic niche-related and cell-intrinsic cues drive lineage specification of hematopoietic multipotent progenitors (MPPs) in the bone marrow (BM) is partly understood. We show that CXCR4 signaling strength regulates localization and fate of MPPs. In mice phenocopying the BM myeloid skewing of patients wit...

    Spatial epigenome-transcriptome co-profiling of mammalian tissues.
    Zhang D. et al.
    Emerging spatial technologies, including spatial transcriptomics and spatial epigenomics, are becoming powerful tools for profiling of cellular states in the tissue context. However, current methods capture only one layer of omics information at a time, precluding the possibility of examining the mechanistic relatio...

    Analyzing genomic and epigenetic profiles in single cells by hybridtransposase (scGET-seq).
    Cittaro D. et al.
    scGET-seq simultaneously profiles euchromatin and heterochromatin. scGET-seq exploits the concurrent action of transposase Tn5 and its hybrid form TnH, which targets H3K9me3 domains. Here we present a step-by-step protocol to profile single cells by scGET-seq using a 10× Chromium Controller. We describ...

    Imaging Chromatin Accessibility by Assay ofTransposase-Accessible Chromatin with Visualization.
    Miyanari Yusuke
    Chromatin accessibility is one of the fundamental structures regulating genome functions including transcription and DNA repair. Recent technological advantages to analyze chromatin accessibility begun to explore the dynamics of local chromatin structures. Here I describe protocols for Assay of Transposase-Accessibl...

    Mouse kidney nuclear isolation and library preparation for single-cell combinatorial indexing RNA sequencing
    Li Haikuo and Humphreys Benjamin D.
    Single-cell combinatorial indexing RNA sequencing (sci-RNA-seq3) enables high-throughput single-nucleus transcriptomic profiling of multiple samples in one experiment. Here, we describe an optimized protocol of mouse kidney nuclei isolation and sci-RNA-seq3 library preparation. The use of a dounce tissue homogenizer...

    Optimized single-nucleus transcriptional profiling by combinatorialindexing.
    Martin Beth K et al.
    Single-cell combinatorial indexing RNA sequencing (sci-RNA-seq) is a powerful method for recovering gene expression data from an exponentially scalable number of individual cells or nuclei. However, sci-RNA-seq is a complex protocol that has historically exhibited variable performance on different tissues, as well a...

    Spatial profiling of chromatin accessibility in mouse and human tissues
    Yanxiang Deng et al.
    Cellular function in tissue is dependent on the local environment, requiring new methods for spatial mapping of biomolecules and cells in the tissue context1. The emergence of spatial transcriptomics has enabled genome-scale gene expression mapping2,3,4,5, but the ability to capture spatial epigenetic informati...

    Spatially resolved epigenome-transcriptome co-profiling of mammalian tissues at the cellular level
    Fan Rong et al.
    Emerging spatial technologies including spatial transcriptomics and spatial epigenomics are becoming powerful tools for profiling cellular states in the tissue context. However, current methods capture only one layer of omics information at a time precluding the possibility to examine the mechanistic relationship ac...

    Reverse-transcribed SARS-CoV-2 RNA can integrate into the genome of cultured human cells and can be expressed in patient-derived tissues
    Liguo Zhang et al.
    Prolonged detection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RNA and recurrence of PCR-positive tests have been widely reported in patients after recovery from COVID-19, but some of these patients do not appear to shed infectious virus. We investigated the possibility that SARS-CoV-2 RNAs can ...

    T-RHEX-RNAseq – A tagmentation-based, rRNA blocked, randomhexamer primed RNAseq method for generating stranded RNAseq librariesdirectly from very low numbers of lysed cells
    Gustafsson Charlotte et al.
    Background: RNA sequencing has become the mainstay for studies of gene expression. Still, analysis of rare cells with random hexamer priming – to allow analysis of a broader range of transcripts – remains challenging. Results: We here describe a tagmentation-based, rRNA blocked, random hexamer primed RNA...

  •  Related products

Events

  • VAI Epigenetics Symposium 2025
    Grand Rapids, Michigan
    Jul 25, 2025
 See all events

 


       Site map   |   Contact us   |   Conditions of sales   |   Conditions of purchase   |   Privacy policy