Hologic Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert sequencing adapters in a single step makes it the perfect companion for next-generation sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.
• Mosaic end_reverse: 5’ [PHO]CTGTCTCTTATACACATCT 3’
• Mosaic end_Adapter A: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’
• Mosaic end_Adapter B: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’
Underlined regions correspond to the double-stranded part of the adapter recognized by the Tagmentase.
The final libraries can be amplified using Hologic Diagenode Primer Indexes for tagmented libraries:
• 24 UDI for tagemented libraries - Set I
• 24 UDI for tagmented libraries - Set II
• 24 UDI for tagmented libraries - Set III
Unit (U) Definition
One unit of Tagmentase (Tn5 Transposase) – loaded is defined as the amount of enzyme required to cleave 30 ng of linearized pUC19 plasmid in 1 hour at 37 °C, generating libraries with an average fragment size below 550 bp under standard conditions.
Storage Conditions
• Store at -20°C.
• Guaranteed stable for six months from the date of receipt when stored properly.
Storage Buffer
• Supplied in a solution containing 50% (v/v) glycerol.
Properties & Usage
• Magnesium Dependency: Tagmentase requires Mg²+ for activity. Avoid chelators (e.g., EDTA, EGTA) in reaction buffers.
• pH and Temperature: The enzyme is active at pH 7.5–8 and 37–55°C.
• Inactivation: SDS, EDTA/EGTA, or heating to 65°C will inactivate the enzyme.
Recommended Buffers
• Tagmentase Dilution Buffer - Hologic Diagenode, Cat. No. C01070011
• Tagmentation Buffer (2x) - Hologic Diagenode, Cat. No. C01019043 - dilute 2x before use
Applications
Tagmentase (Tn5 transposase) - loaded can be used in a wide range of applications to create libraries for next-generation sequencing. Recommended amounts per reaction are as follows:
• Genomic DNA tagmentation: 0.25–1 U per 25–100 ng of DNA
• ATAC-seq: 0.3 U per 50,000 cells
• ChIPmentation: 0.125 U per reaction
Please note that additional optimization, including enzyme dose- and time-response experiments, may be required for custom protocols.
Recommended Protocols
For ATAC-seq and ChIPmentation, we recommend using validated Hologic Diagenode protocols:
• ATAC-seq Kit - Hologic Diagenode, Cat. No. C01080002
• ChIPmentation Kit for Histones - Hologic Diagenode, Cat. No. C01011009
• μChIPmentation Kit for Histones - Hologic Diagenode, Cat. No. C01011011
• TAG Kit for ChIPmentation - Hologic Diagenode, Cat. No. C01011030
Quality Control
Each new lot of Tagmentase undergoes comprehensive quality control to ensure it meets designated specifications. The following assays are performed:
• Protein Purity and Integrity by SDS-PAGE
• Nuclease Activity to confirm the absence of nonspecific DNase activity
• Enzymatic Transposase Activity using a pUC19 cleavage assay and associated library preparation
• Functional by ATAC-seq, including checks for contaminating DNA from E. coli
Precautions
This product is for research use only. It is not intended for use in diagnostic or therapeutic procedures.